ildewmwh ildewmwh

01-05-2018
Mathematics

contestada

find the greatest common factor 9x^2a + 9xa^2

Respuesta :

CastleRook CastleRook

11-05-2018

To get the GCF we proceed as follow:
9x^2a+9xa^2
factor out 9 we get:
9(x^2a+xa^2)
=factoring out x we get
9x(xa+a^2)
factoring out a we get
9ax(x+a)
therefore the GCF is 9ax

Answer Link

Otras preguntas

How many 1900 galveston hurricane facts homes and buildings was destroyed?

The number of students in the book club is increasing at a rate of 15% per year. In 2010 there were 9 students in the book club. Find the number of students exp

what is the theoretical probability of picking a diamond from a standard deck of car

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

why is derek miller's social media post different than most?

(50)points 5 questions!

Find the missing value. sin x = .65

help quick please!! Thanks

Cheney is buying a house for $216,820. He made a down payment of $26,020 and will finance $190,800. He gets a 15 year fixed rate loan with a rate of 5.815%. Ho

Which words from the text predict the nature of the coming civil war? jeopardy, bitterly, crisis famous, dissatisfied, possessions regulate, foreshadowed, platf