sathehawk sathehawk
  • 02-06-2017
  • Mathematics
contestada

What is the slope of the line that goes through points(-2,2),and(-4,-2)

Respuesta :

fussellk
fussellk fussellk
  • 02-06-2017
slope = y2 - y1/x2 - x1
slope = -2 - 2/-4 - -2
slope = -4/-2
slope = 2
Answer Link

Otras preguntas

Please help with Algebra 1
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
What is the sum of 6/10 plus 7/12
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic