04-04-2017
Mathematics

contestada

why are expressions 3(y-2)+2(y-2) and 5(y-2) equivalent

Respuesta :

Goalinetsky Goalinetsky

04-04-2017

3(y-2) + 2(y-2) = 5(y-2)

Both terms have the base (y-2), so they can be added together.
3 + 2 = 5

Answer Link

Otras preguntas

how is the graph of y=9(3)^x+2 +6 translated from the graph of y+9(3)^x

What did Theodore Roosevelt do before he was elected president at the age of 42?

This rectangular prism is created with centimeter cubes. how many cubed centimeters make up this prism? rectangular prism composed of unit cubes. cm3

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What are two concepts of government democracy?

Exponential Equation WITHOUT CALCULATOR

People and societies in which they live lie outside the biosphere.

Tyra makes $21.40 per hour at her job for the first 40 hours and $32.10 for anything over 40 hours. if tyra typically works 45 hours per week, how much does she

Many assume that presidents with high __________ are more effective leaders.

For how many different values of θ between 0 and 2π radians is sec x = csc x ?