dmoney02 dmoney02
  • 02-03-2017
  • Geography
contestada

Fault lines in a sentence

Respuesta :

lostepoch28 lostepoch28
  • 02-03-2017
The edges of tectonic plates that move away, towards or past each other.
Answer Link

Otras preguntas

Please help me with this homework
Choose the correct placement for the commas in this sentence."Well" Professor Hawkins sighed "I guess no one is taking my class this semester."Choose 1 answer:C
a cost for a pack of 25 pencils is $4:75. what is the unit price
a split-brain patient has a picture of a cow flashed to her left hemisphere and that of a fork, to her right hemisphere. she will be able to
HELP ME! BRAINLIEST TO THE ONE WHO GETS IT RIGHT!!! Drag the tiles to the correct boxes to complete the pairs. Not all tiles will be used. Match the expressions
Which process is a form of autotrophic nutrition? A) transport B) regulation C)fermentation D) photosynthesis
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Which of the following sentences is a third conditional?A.If it doesn’t rain, plants cannot grow.B.If Steve buys a car, he will drive us to school.C.If his moth
what is the area of the rectangle that is 3/2 tall and 6/2 long explain how you got your answer.
help please this is making my head hurt