valentines2005
valentines2005 valentines2005
  • 04-03-2021
  • Mathematics
contestada

how do i solve for x

how do i solve for x class=

Respuesta :

sonnycortez
sonnycortez sonnycortez
  • 04-03-2021

Answer:

55

Step-by-step explanation:

Answer Link

Otras preguntas

Who was the u.s. general fired during the korean war for trying to create another world war with china?
Identify the specific sensory receptors for each of the five common senses.
With respect to their direct effects on osseous tissue, which pair of hormones has actions that oppose each other?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Why would a signature item, such as distinctive button or tag, be considered a need even if it was not essential to the item’s function? -f someone powerful in
For some time, the English had little interest in colonizing for what two reasons?
Do cones and polyhedrons both have only one base true or false
what is the sum of odd positive integers less than 50
A circular swimming pool has a diameter of 12 feet. What is the circumference the pool? Use 3.14 to approximate for π . Enter your answer, as a decimal rou
What did Jimmy Carter base his views on foreign-policy?