Londynkohn Londynkohn

04-03-2021
Mathematics

contestada

I have 7 questions in all, I will be giving brainlest

I have 7 questions in all I will be giving brainlest class=

Respuesta :

milessweaze milessweaze

04-03-2021

Answer:

10.5

Step-by-step explanation:

Answer Link

jaronnugent69 jaronnugent69

04-03-2021

Answer:

10.5 sorry it took so long im a little crusty

Step-by-step explanation:

Answer Link

Otras preguntas

How are organelles adapted for their functions

Most Chinese governments after the Han dynasty used civil service exams to select people for positions within the government. How did these exams contribute to

i need help with this question asap!!I will give brainliest!!!please and thank you

please help me :(((((((

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

which political philosophers were largely inspired by the english civil war to write about the government

Help I will be marking brainliest!!! A. 22 B. 44√2 C. 22√2 D. 44 Show work, if possible. Thanks❤️

What is most intriguing to you about this painting? Check any that apply. A. the dark and light colors B. the textured paint style C. the shape of the objects D

Write the decimal as a percent. 20= .......?%

Place the steps of the DECIDE Model into the correct order: = Consider all of your options and possible consequences of each = Evaluate the outcome = Determine