alexanderhg1221 alexanderhg1221

02-03-2021
Mathematics

contestada

Graph the compound inequality on the number line. x> -7 and x<-3

Respuesta :

XpertthiefFan XpertthiefFan

02-03-2021

Answer:

Step-by-step explanation:

Ver imagen XpertthiefFan

Answer Link

Otras preguntas

In judith ortiz cofer's "gravity," what is elenita's main internal conflict? a.she wants an independent identity, and yet still feels a connection to others. b.

Researchers are exploring whether treatment with ________ might improve social behavior in those with asd.

What would be the △Y and the △X for the line that passes through the points (–5, 4) and (2, –2)

Let f(x) = x+7 and g(x) = x-4 Find f(x) times g(x)

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

A relation is A. the output (y) values of the relation B. the input (x) values of the relation C. a set of points that pair input values with output values D. x

Four hundred people live on a pacific island and 16 are homozygous recessive for a trait that has only two different types of alleles in the population. how man

I need help on exterior angles!

Separation of ownership and control creates an agency problem when an agent pursues goals that conflict with the principals' goals. Principals establish and use

what is the theoretical probability of picking a diamond from a standard deck of car