r8drnayshun r8drnayshun
  • 03-12-2014
  • Mathematics
contestada

A rectangular bedroom floor has an area of 100 square feet and a length of 10 feet. What is the perimeter on the floor?

Respuesta :

18dnguye 18dnguye
  • 03-12-2014
I'm guessing the the length is 10? So it would be a square, 4 sides of equal length So 10 x 4 = 40 It would be 40 feet
Answer Link

Otras preguntas

The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
the perimeter of a square 116ft ?
define concentric circles
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
Susan ........ (Run) to school because she was late.