muak46jstv muak46jstv

01-12-2020
Biology

contestada

How many total atoms are present in the compound 2Ca(OH)2 I’ll give brainliest on both

Respuesta :

elisabethfaithdaun elisabethfaithdaun

01-12-2020

i think there are 10 atoms present

Answer Link

Otras preguntas

Use factoring to simplify the expression x^2-x-6/x-3 assume that x does not equal 3

With respect to their direct effects on osseous tissue, which pair of hormones has actions that oppose each other?

Which English reformer called for change in the church during the 1300's

Help with geometry!!!

How and where (at what latitudes) do atmospheric convection cells form?

what does the liver do in the excretory system

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

30. Chronic alcohol abuse damages T-cells, white blood cells, natural killer cells, and __________, all important components of the immune system. A. acetaldehy

How did the cold war shape american culture in the late 1950s and 1960s? what was the most important impact?

The long-reigning absolutist king of france, __________, portrayed himself as the "sun king."