julzy julzy
  • 01-09-2020
  • Mathematics
contestada

explain what it means when an angle has radian measure 1

Respuesta :

Donna2173
Donna2173 Donna2173
  • 01-09-2020

Answer:

1 radian has degree measure (180/)°. Likewise, and angle of size 1° has radian measure /180. We can now easily obtain a formula to convert from degrees to radians and vice-versa.

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
4(3-5)=-2(8-z)-6z what is z
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
what is the most common type of vegetation throughout Latin America
Can someone answer my question plz!!!! It's in the picture and show your work!!!!!
the temperature of a sample of matter is a measure of the ?