MiMiGordon MiMiGordon

02-11-2014
Mathematics

contestada

Find the value of 2 in this equation.

33- (8t) = 15

Respuesta :

chipperrider chipperrider

02-11-2014

33 - 8t = 15
-8t = 15 - 33
-8t = -18
t = -18 / -8
t = 2.25

Answer Link

02-11-2014

33-8t=15
33-15=8t
18=8t
18/8=t
t=2.25

Answer Link

Otras preguntas

Between 1920 and 1930, almost a million african american's left the south for the "promised land" up north during the

what's the ph of citric acid

A major weakness of the new constitution was the bill of rights. a. True b. False

For which of the following materials is necessary to stop a beta particle? A. Three feet of concrete B. Three inches of lead C. Thin pieces of wood D. Single s

circadian rhythm refers to

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

in 1990, there were 350 cell phone subscribers in the small town of Centerville. The number of subscribers increased by 35% per year after 1990

The oxygen moves into the blood system from the lungs by the process. A.Exhalation B.Osmosis C.Diffusion D.Respiration

While the theme of "Ode on a Grecian Urn" focuses on how art is eternal, the theme of "Ozymandias" focuses on how a.royalty is superior. b.nature endures. c.thi

The process through which thoughts and actions become routine is ______.