jf32707 jf32707
  • 03-07-2020
  • Mathematics
contestada

(35–34)(33+32) is divisible by 24;

Respuesta :

adityajadhav192005
adityajadhav192005 adityajadhav192005
  • 03-07-2020

problem decoded dude

answer is in attachment

Ver imagen adityajadhav192005
Answer Link

Otras preguntas

A man has blood type AB and his wife has blood type B. What are the possible blood types for their child
CAN SOMEONNE HELP ME PLEASE !!!
Suppose the heights of 18-year-old men are approximately normally distributed, with mean 67 inches and standard deviation 5 inches. (a) what is the probability
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What does the lambic system do? A. registers feelings, such as fear and pleasure B. directs incoming sensory messages C. coordinates involuntary muscle movemen
Which correctly describes the reaction between potassium and excess water?
when she turned 18, Kaitlyn purchased 130 shares of stock A for $47 per share; 68 shares of stock B for $32 per share; 71 shares of stock C for $102 per shar
Why do you think James Meredith continued his march, even after he was shot?
(-6x^3+2x^2-2x)/(2x-1) how do I solve using long division?
The somatosensory area is to the auditory area what the _____ lobe is to the _____ lobe