cottoncandy1281 cottoncandy1281
  • 03-10-2014
  • Mathematics
contestada

The cost for n students to attend a workshop is 7n+12 dollars. What is the cost,in dollars for  students to attend?

Respuesta :

SMZ
SMZ SMZ
  • 04-10-2014
You would divide both 12 and 7n by 7. To isolate the variable. You end up with 5+n. You can not say 5n because you cannot combine unlike terms. Your answer would be 5+n. Hope this helps
Answer Link

Otras preguntas

in what area of Europe were the majority of warsaw pact countries
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
Round 46.895 to the nearest tenth
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
according to the United States constitution the president has the power to (A) negotiate treaties (B) amend the constitution (C) impeach members of congress
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
find the prime factorization 504