abieber7945 abieber7945
  • 02-06-2018
  • Social Studies
contestada

Rick was so successful with his sweet treats franchise that he opened several other sweet treats locations. rick could best be described as:

Respuesta :

vedros
vedros vedros
  • 02-06-2018
he would be described as an entrepreneur.
Answer Link

Otras preguntas

Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
Solve the equation -10 + 3x + 5x = -56 ? ??
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
Do you think then solid can undergo convection
Can someone answer my question plz!!!! It's in the picture and show your work!!!!!
Why did the American public mostly oppose joining the League of Nations after WWI?
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5